Cybertory™ Sequencing Simulator - Reaction Parameters

HIV mutants Template Set

User name:
Template:
Primer sequence:
Primer strand:
Priming site:
Primer purity:
Primer concentration (µM):
Annealing temperature:
Enzyme:
Label:
Output format:

Suggested HIV genotyping primers


These can be copied and pasted into the "primer" box above.
Name
Sequence
Location
proF
AGCCAACAGCCCCACCAG
2150-2167
proR
GGGCCATCCATTCCT
2605-2588
rt1F
GTTAAACAATGGCCATTGACAGAAGA 
2610-2635
rt1R
CCATCCCTGTGGAAGCACATTG
3008-2987
rt2F
TGGAAAGGATCACCAGCAATATTCCA 
3006-3031
rt2R
CTGTATTTCTGCTATTAAGTCTTTTGATG
3438-3462
rt3F
AAGAAGCAGAGCTAGAACTGGCAGA
3439-3463
rt3R
AATGCATATTGTGAGTCTG
4057-4039
from U.S. Patent 6,379,957

Naming Scheme

Trace file names use this naming scheme for analysis with the Staden package.